NAME:_____________________________            SS#:__________________________

 

L325 Worksheet 9: Due 04/22/05

REMEMBER: The ÒFor CreditÓ problems are due at the end of your learning group.  You must at least make an attempt to answer ALL of the problems Before coming to class.

Recommended Text Problems: Chap. 23: 1, 4-6, 8-13; Chap. 26: 2, 3, 5, 7, 13

 

ÒFor CreditÓ Problems:

  1. A couple has one male child with bilateral retinoblastoma.  The mother is free from cancer, but the father had unilateral retinoblastoma and he has a brother who has bilateral retinoblastoma.

 

A)   If the couple has another child, what is the probability that this next child will have retinoblastoma?

 

                       

 

 

 

 

B)   If the next child has retinoblastoma, is it likely to be unilateral or bilateral?

 

                       

 

 

 

 

C)   Propose an explanation for why the fatherÕs case was unilateral, whereas his sonÕs and brotherÕs case was bilateral.

 

                       

 

 

 

 

 

  1. Some cancers are consistently associated with the deletion of a part of a chromosome, for example neuroblastoma is often associated with a deletion in the p arm of chromosome 13.  Does the deleted region contain an proto-oncogene or a tumor suppressor gene?

 

 

 

 

 

 

 

 

  1. Proto-oncogenes code for a diverse set of gene products. 

 

A)   What type of roles do proteins produced from proto-oncogenes typically play in the cell cycle?

 

 

 

 

 

B)   Which of the following mutations in a proto-oncogene might result in an oncogene?  Explain (2 pts.)

 

i)               a deletion of an entire region of a proto-oncogene

ii)             a deletion of a silencer that lies 5Õ to the coding region

iii)            a deletion of an enhancer that lies 3Õ to the coding region

iv)            a translocation that places the coding region near a constitutively transcribed gene

 

 

 

 

 

 

 

 

 

4.      The following are two DNA sequences from gene X in the American robin and the European robin, respectively:

                        TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA

 

            GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT

 

            The 2 sequences do not begin and end at the same location.  Try to line them up according to their homologous regions (2 pts.).

.

 

 

 

 

 

  1. Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene?  Explain your answer.  (2 pts. Total).