NAME:_____________________________
SS#:__________________________
REMEMBER: The ÒFor CreditÓ problems are due at the end of
your learning group. You must at
least make an attempt to answer ALL of the problems Before coming to class.
Recommended Text Problems: Chap. 23: 1, 4-6, 8-13; Chap. 26: 2, 3, 5, 7, 13
ÒFor CreditÓ Problems:
A) If the couple has another child, what is the probability that this next child will have retinoblastoma?
B) If the next child has retinoblastoma, is it likely to be unilateral or bilateral?
C) Propose an explanation for why the fatherÕs case was unilateral, whereas his sonÕs and brotherÕs case was bilateral.
A) What type of roles do proteins produced from proto-oncogenes typically play in the cell cycle?
B) Which of the following mutations in a proto-oncogene might result in an oncogene? Explain (2 pts.)
i) a deletion of an entire region of a proto-oncogene
ii) a deletion of a silencer that lies 5Õ to the coding region
iii) a deletion of an enhancer that lies 3Õ to the coding region
iv) a translocation that places the coding region near a constitutively transcribed gene
4. The following are two DNA sequences from gene X in the American robin and the European robin, respectively:
TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA
GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT
The 2 sequences do not begin and end at the same location. Try to line them up according to their homologous regions (2 pts.).
.